RNA sequences with modifications

Showing 691 sequences.

 accept|  |   D-domain      ||anticodon domain ||   variable region   ||   T-domain    ||accept|
        10|        20|         30|       40|                          50|       60|       70|      
Typeaa typeAnticodonOrganismOrganellum
tRNAPhe#AAGeobacillus stearothermophilusprokaryotic cytosol -GGCUCGG4AGCUCAGUC-GGD--AGAGCAAAGGACU#AA*APCCUUGU-------------------7UCGGCGGTPCGAUUCCGUCCCGAGCCACCA
tRNAPyrCUAMethanosarcina barkeriprokaryotic cytosol -GGAAACC4-GAUCA-U--G-U--AGAUCG_UGGACUCUAAAUCCG_CA---------------------GCCGGG]UAGAUUCCCGGGGUUUCCGCCA
tRNAArgACGAscaris suummitochondrial -GGACGUU""AUAGAU---AA---GCUAPGCCPAGPUACGKPCPGGGAA-------------------G-AG---------------AGUCGPCUUCCA
tRNASerUCUAscaris suummitochondrial -GACAAAUG-----------------UUUPCAGGUCUUCU6AAPCUGUUUU--------------------GGA--GAAA-----UCCGPUUGUUUCCA
tRNAGlu!UCAscaris suummitochondrial -GAGAUAUU"GUAUAAAUUUUU--UGUAPAPUPCUPU!UCKAAGAAAAG-------------------G-U-----UUA---------UUAUCPUACCA
tRNAGln!UGAscaris suummitochondrial -UAUACUUU"GUUUAGGA------AGAAUAPUUAPPU!UGKPGPAAAAG-------------------G-G-----UUG---------UAGUAPAGCCA
tRNATrp$CAAscaris suummitochondrial -ACAGAUUU"AGUUAAGUUU----AAACUCPPGGPPU$CA*AACCAAAA-------------------A-U-----UUU---------ACUCPGUACCA
tRNALeu$AAAscaris suummitochondrial -GPUGUUAU"GCAUAAGA------AGUGCAPPUGPPU$AAKCGPAAAAG-------------------A-U-----AUG---------GGACAACUCCA
tRNASerGCUBos taurusmitochondrial -GAAAAAG-U----------------AUGCAAGAACUGCU6AUUC_UGCUC--------------------?CAUAUCUAAU_UAUGGCUUUUUCGCCA