RNA sequences with modifications

 accept|  |   D-domain      ||anticodon domain ||   variable region   ||   T-domain    ||accept|
        10|        20|         30|       40|                          50|       60|       70|      
Typeaa typeAnticodonOrganismOrganellum
012345678901234567-890--1234567890123456789012345eeeeeeeeeeeeeeeeeee6789012345678901234567890123456
tRNAAlaVGCEscherichia coliprokaryotic cytosol -GGGGCUAUAGCUCAGCD-GGG--AGAGCGCCUGCUUVGCACGCAGGAG-------------------7UCUGCGGTPCGAUCCCGCAUAGCUCCACCA
tRNAAlaGGCEscherichia coliprokaryotic cytosol -GGGGCUAUAGCUCAGCD-GGG--AGAGCGCUUGCAUGGCAUGCAAGAG-------------------7UCAGCGGTPCGAUCCCGCUUAGCUCCACCA
tRNAArgICGEscherichia coliprokaryotic cytosol -GCAUCCG4AGCUCAGCD-GGAD-AGAGUACUCGG%UICG/ACCGAGCG-------------------7XCGGAGGTPCGAAUCCUCCCGGAUGCACCA
tRNAArgCCGEscherichia coliprokaryotic cytosol -GCGCCCGUAGCUCAGCD-GGAD-AGAGCGCUGCC%UCCGKAGGCAGAG-------------------7UCUCAGGTPCGAAUCCUGUCGGGCGCGCCA
tRNAArgUCUEscherichia coliprokaryotic cytosol -GCGCCCUUAGCUCAGUU-GGAU-AGAGCAACGAC%U{CU6AGPCGUGG-------------------GCCGCAGGTPCGAAUCCUGCAGGGCGCGCCA
tRNAAsnGUUEscherichia coliprokaryotic cytosol -UCCUCUG4AGUUCAGDC-GGD--AGAACGGCGGACUQUU6APCCGUAU-------------------7UCACUGGTPCGAGUCCAGUCAGAGGAGCCA
tRNAAsp⊄UCEscherichia coliprokaryotic cytosol -GGAGCGG4AGUUCAGDC-GGDD-AGAAUACCUGCCUUC/CGCAGGGG-------------------7UCGCGGGTPCGAGUCCCGPCCGUUCCGCCA
tRNACysGCAEscherichia coliprokaryotic cytosol -GGCGCGU4AACAAAGC--GGD--DAUGUAGCGGAPUGCA*APCCGUCU-------------------A-GUCCGGTPCGACUCCGGAACGCGCCUCCA
tRNAGlnUUGEscherichia coliprokaryotic cytosol -UGGGGUA4CGCCAAGC--#GD--AAGGCACCGGUJU$UG/PACCGGCA-------------------UUCCCUGGTPCGAAUCCAGGUACCCCAGCCA
tRNAGlnCUGEscherichia coliprokaryotic cytosol -UGGGGUA4CGCCAAGC--#GD--AAGGCACCGGAJUCUG/PPCCGGCA-------------------UUCCGAGGTPCGAAUCCUCGUACCCCAGCCA
tRNAGluSUCEscherichia coliprokaryotic cytosol -GUCCCCUUCGUCPAGA--GGCCCAGGACACCGCCCUSUC/CGGCGGUA-------------------A-CAGGGGTPCGAAUCCCCUAGGGGACGCCA
tRNAGlyCCCEscherichia coliprokaryotic cytosol -GCGGGCG4AGUUCAAU--GGD--AGAACGAGAGCUUCCCAAGCUCUAU-------------------A-CGAGGGTPCGAUUCCCUUCGCCCGCUCCA
tRNAGly{CCEscherichia coliprokaryotic cytosol -GCGGGCAUCGUAUAAU--GGCU-AUUACCUCAGCCU{CCAAGCUGAUG-------------------A-UGCGGGTPCGAUUCCCGCUGCCCGCUCCA
tRNAGlyGCCEscherichia coliprokaryotic cytosol -GCGGGAAUAGCUCAGDD-GGD--AGAGCACGACCUUGCCAAGGUCGGG-------------------7UCGCGAGTPCGAGUCUCGUUUCCCGCUCCA
tRNAHisGUGEscherichia coliprokaryotic cytosol GGUGGCUA4AGCUCAGDD-GGD--AGAGCCCUGGAUUQUG/PPCCAGUU-------------------7UCGUGGGTPCGAAUCCCAUUAGCCACCCCA
tRNAIleGAUEscherichia coliprokaryotic cytosol -AGGCUUGUAGCUCAGGD-GGDD-AGAGCGCACCCCUGAU6AGGGUGAG-------------------7XCGGUGGTPCAAGUCCACPCAGGCCUACCA
tRNAIleCAUEscherichia coliprokaryotic cytosol -GGCCCCU4AGCUCAGU--#GDD-AGAGCAGGCGACU}AU6APCGCUUG-------------------7XCGCUGGTPCAAGUCCAGCAGGGGCCACCA
tRNALeuCAGEscherichia coliprokaryotic cytosol -GCGAAGGUGGCGGAADD-#GDA-GACGCGCUAGCUUCAGKPGPUAGU-GUCC---UUAC----GGACG-UGGGGGTPCAAGUCCCCCCCCUCGCACCA
tRNALeuGAGEscherichia coliprokaryotic cytosol -GCCGAGGUGGUGGAADD-#GDA-GACACGCUACCUUGAGKPGGUAGU-GCCC---AAUA----GGGCU-UACGGGTPCAAGUCCCGUCCUCGGUACCA
tRNALeu)AAEscherichia coliprokaryotic cytosol -GCCCGGA4GGUGGAADC-#GDA-GACACAAGGGAPU)AA*APCCCUC-GGCG---UUCG----CGCUG-UGCGGGTPCAAGUCCCGCUCCGGGUACCA
tRNALeuBAAEscherichia coliprokaryotic cytosol -GCCGAAG4GGCGAAADC-#GDA-GACGCAGUUGAPUBAA*APCAACC-GUA----GAAA-----UACG-UGCCGGTPCGAGUCCGGCCUUCGGCACCA
tRNALysSUUEscherichia coliprokaryotic cytosol -GGGUCGUUAGCUCAGDD-GGD--AGAGCAGUUGACUSUU6APCAAUUG-------------------7XCGCAGGTPCGAAUCCUGCACGACCCACCA
tRNAMetMAUEscherichia coliprokaryotic cytosol -GGCUACG4AGCUCAGDD-#GDD-AGAGCACAUCACUMAU6APGAUGGG-------------------7XCACAGGTPCGAAUCCCGUCGUAGCCACCA
tRNAPheGAAEscherichia coliprokaryotic cytosol -GCCCGGA4AGCUCAGDC-GGD--AGAGCAGGGGAPUGAA*APCCCCGU-------------------7XCCUUGGTPCGAUUCCGAGUCCGGGCACCA
tRNAProCGGEscherichia coliprokaryotic cytosol -CGGUGAUUGGCGCAGCCUGGD--AGCGCACUUCGUUCGGKACGAAGGG-------------------7UCGGAGGTPCGAAUCCUCUAUCACCGACCA
tRNASecUCAEscherichia coliprokaryotic cytosol -_AAGAUCG4CGUCUCC--GGDG-AGGCGGCUGGACUUCA+AUCCAGU-UGGGGCCGC_GCGGUCCCG--GGCAGGTPCGACUCCUGUGAUCUU_GCCA
tRNASerUGAEscherichia coliprokaryotic cytosol -GGAAGUG4GGCCGAGC--#GDDGAAGGCACCGGUBUVGA*AACCGGC-GACCC--GAAA---GGGUU--CCAGAGTPCGAAUCUCUGCGCUUCCGCCA
tRNASerCGAEscherichia coliprokaryotic cytosol -GGAGAGAUGCCGGAGC--#GCDGAACGGACCGGUCUCGA*AACCGGA-GUAGGG-GCAA--CUCUAC--CGGGGGTPCAAAUCCCCCUCUCUCCGCCA
tRNASerGCUEscherichia coliprokaryotic cytosol -GGUGAGG4GGCCGAGA--GGCDGAAGGCGCUCCC%UGCU6AGGGAGU-AUGCGGUCAAAAGCUGCAU--CCGGGGTPCGAAUCCCCGCCUCACCGCCA
tRNASerGGAEscherichia coliprokaryotic cytosol -GGUGAGG4GUCCGAGU--#GDDGAAGGAGCACGCCUGGAAAGPGUGU-AUACG--GCAA---CGUAU--CGGGGGTPCGAAUCCCCCCCUCACCGCCA
tRNAThrGGUEscherichia coliprokaryotic cytosol -GCUGAUAUGGCUCAGDD-GGD--AGAGCGCACCCUUGGUEAGGGUGAG-------------------7UCCCCAGTPCGACUCUGGGUAUCAGCACCA
tRNAThrGGUEscherichia coliprokaryotic cytosol -GCUGAUAUAGCUCAGDD-GGD--AGAGCGCACCCUUGGUEAGGGUGAG-------------------7UCGGCAGTPCGAAUCUGCCUAUCAGCACCA
tRNATrpCCAEscherichia coliprokaryotic cytosol -AGGGGCG4AGUUCAADD-GGD--AGAGCACCGGUBUCCA*AACCGGGU-------------------7UUGGGAGTPCGAGUCUCUCCGCCCCUGCCA
tRNATyrQUAEscherichia coliprokaryotic cytosol -GGUGGGG44CCCGAGC--#GCCAAAGGGAGCAGACUQUA*APCUGCC-GUC----AUC------GACUUCGAAGGTPCGAAUCCUUCCCCCACCACCA
tRNATyrQUAEscherichia coliprokaryotic cytosol -GGUGGGG44CCCGAGC--#GCCAAAGGGAGCAGACUQUA*APCUGCC-GUC----ACA------GACUUCGAAGGTPCGAAUCCUUCCCCCACCACCA
tRNAValVACEscherichia coliprokaryotic cytosol -GGGUGAU4AGCUCAGCD-GGG--AGAGCACCUCCCUVAC=AGGAGGGG-------------------7UCGGCGGTPCGAUCCCGUCAUCACCCACCA
tRNAValGACEscherichia coliprokaryotic cytosol -GCGUCCG4AGCUCAGDD-GGDD-AGAGCACCACCUUGACAUGGUGGGG-------------------7XCGGUGGTPCGAGUCCACUCGGACGCACCA
tRNAValGACEscherichia coliprokaryotic cytosol -GCGUUCA4AGCUCAGDD-GGDD-AGAGCACCACCUUGACAUGGUGGGG-------------------7XCGUUGGTPCGAGUCCAAUUGAACGCACCA
tRNAIniCAUEscherichia coliprokaryotic cytosol -CGCGGGG4GGAGCAGCCUGGD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGUCGGTPCAAAUCCGGCCCCCGCAACCA
tRNAIniCAUEscherichia coliprokaryotic cytosol -CGCGGGG4GGAGCAGCCUGGD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------AUCGUCGGTPCAAAUCCGGCCCCCGCAACCA
tRNAAsnQUUAzospirillum lipoferumprokaryotic cytosol -UUCACAGUAGCUCAGU--GGD--AGAGCUAUCGGCUQUU6ACCGAUCG-------------------AUCGUAGGTPCGAGUCCUACCUGUGAAUCCA
tRNAAsnQUUAzospirillum lipoferumprokaryotic cytosol -UUCACAGUCGCUCAGU--GGD--AGAGCUAUCGGCUQUU6ACCGAUCG-------------------AUCGUAGGTPCGAGUCCUACCUGUGAAUCCA
tRNAAlaUGCBacillus subtilisprokaryotic cytosol -GGAGCCUUAGCUCAGCD-GGG--AGAGCGCCUGCUU5GC=CGCAGGAG-------------------7UCAGCGGTPCGAUCCCGCUAGGCUCCACCA
tRNAAlaGGCBacillus subtilisprokaryotic cytosol -GGGGCCAUAGCUCAGCD-GGG--AGAGCGCUACGCUGGCAGCGUAGAG-------------------7UCAGGGGTPCGAGCCCCCUUGGCUCCACCA
tRNAArgICGBacillus subtilisprokaryotic cytosol -GCGCCCGUAGCUCAAU--GGAD-AGAGCGUUUGACUICGKAUCAAAAG-------------------7UUAGGGGTPCGACUCCCCUCGGGCGCGCCA
tRNAArgUCUBacillus subtilisprokaryotic cytosol -GUCCCAGUAGCUCAGCD-GGAD-AGAGCAACGGCCUUCU6AGCCGUCG-------------------7UCGGGAGTPCGAAUCUCUCCUGGGACGCCA
tRNAArgCCUBacillus subtilisprokaryotic cytosol -GCUCUAGUAGCACAGC--GGAD-AGUGCAGCAGUUUCCU6AACUGCAG-------------------7UCGGGAGTPCGAAUCUCUCCUAGAGCGCCA
tRNAArgCCGBacillus subtilisprokaryotic cytosol -GCGCUCGUAGCUCAGUU-GGAD-AGAGCGGUGGUUUCCGKUACCACGGUCG----------------UCCGGGGGTPCGAAUCCCUCCGAGCGCGCCA
tRNAGlyGCCBacillus subtilisprokaryotic cytosol -GCGGAAGUAGUUCAGU--GGD--AGAACACCACCUUGCCAAGGUGGGG-------------------7UCGCGGGTPCGAAUCCCGUCUUCCGCUCCA
tRNAGly!CCBacillus subtilisprokaryotic cytosol -GCGGGUGUAGUUUAGU--GGD--AAAACCUCAGCCU!CCAAGCUGAUG-------------------U-CGUGAGTPCGAUUCUCAUCACCCGCUCCA
tRNAIle}AUBacillus subtilisprokaryotic cytosol -GGACCUUUAGCUCAGUU-GGUU-AGAGCAGACGGCU}AU6ACCGUCCG-------------------7UCGUAGGTPCGAGUCCUACAAGGUCCACCA
tRNALeuCAGBacillus subtilisprokaryotic cytosol -GCGGGUGUGCGGGAAUD-GGDA-GACCGGCUAGAUUCAGKAPCUAGGGUCU----UUAU----GGACC-UGAGGGTPCA"GUCCCUUCACCCGCACCA
tRNALeuUAGBacillus subtilisprokaryotic cytosol -GCGGGUGUGGCGGAAUD-GGCA-GACGCGCUAGACUUAGKAPCUAGUGUUUU---AUGA-------CGUUGGGGGTPCAAGUCCCUUCACCCGCACCA
tRNALys$UUBacillus subtilisprokaryotic cytosol -GAGCCAUUAGCUCAGUD-GGD--AGAGCAUCUGACU$UU[APCAGAGG-------------------7UCGAAGGTPCGAGUCCUUCAUGGCUCACCA
tRNAMetCAUBacillus subtilisprokaryotic cytosol -GGCGGUGUAGCUCAGC--GGCD-AGAGCGUACGGUUCAU=CCCGUGAG-------------------7DCGGGGGTPCGAUCCCCUCCGCCGCUACCA
tRNAPhe#AABacillus subtilisprokaryotic cytosol -GGCUCGGUAGCUCAGUD-GGD--AGAGCAACGGACU#AA*APCCGUGU-------------------7UCGGCGGTPCGAUUCCGUCCCGAGCCACCA
tRNAPro5GGBacillus subtilisprokaryotic cytosol -CGGGAAGUAGCUCAGCUUGGD--AGAGCACAUGGPU5GGKACCAUGGG-------------------7UCGCAGGTPCGAAUCCUGUCUUCCCGACCA
tRNASerGCUBacillus subtilisprokaryotic cytosol -GGAGAAGUACUCAAGU--GGCDGA"GAGGCGCCCCUGCU6AGGGUGUAGGUCGC-GUAA---GCGGCG-CGAGGGTPCAAAUCCCUCCUUCUCCGCCA
tRNASer5GABacillus subtilisprokaryotic cytosol -GGAGGAA4ACCCAAGUCUGGCDGA"GGGAUCGGUCU5GA+AACCGACAGGGUG--UCAA---AGCCCG-CGGGGGTPCGAAUCCCUCUUCCUCCGCCA
tRNASerGGABacillus subtilisprokaryotic cytosol -GGAGAGC4GUCCGAGU--GGDCGA"GGAGCACGAUUGGAAAPCGUGUAGGCGGU-CAAC--UCCGUCU-CAAGGGTPCGAAUCCCUUGCUCUCCGCCA
tRNAThr5GUBacillus subtilisprokaryotic cytosol -GCCGGUGUAGCUCAAUD-GGD--AGAGCAACUGACU5GU6APCAGUAG-------------------7UUGGGGGTPCAAGUCCUCUUGCCGGCACCA
tRNATrpCCABacillus subtilisprokaryotic cytosol -AGGGGCAUAGUUUAAC--GGD--AGAACAGAGGPCUCCA+AACCUCCG-------------------G-UGUGGGTPCGAUUCCUACUGCCCCUGCCA
tRNATyrQUABacillus subtilisprokaryotic cytosol -GGAGGGG4AGCGAAGU--GGCUAA"CGCGGCGGACUQUA*APCCGCU-CCC----UCA------GGGUUCGGCAGTPCGAAUCUGCCCCCCUCCACCA
tRNAVal5ACBacillus subtilisprokaryotic cytosol -GGAGGAUUAGCUCAGCD-GGG--AGAGCAUCUGCCU5AC=AGCAGAGG-------------------7UCGGCGGTPCGAGCCCGUCAUCCUCCACCA
tRNAValGACBacillus subtilisprokaryotic cytosol -GAUUCCGUAGCUCAGCD-GGG--AGAGCGCUACCUUGACAGGGUAGAG-------------------7UCGCUGGTPCGAGCCCAGUCGGAAUCACCA
tRNAIniCAUBacillus subtilisprokaryotic cytosol -CGCGGGGUGGAGCAGUUCGGD--AGCUCGUCGGGCUCAUAACCCGAAG-------------------GUCGCAGGTPCAAAUCCUGCCCCCGCAACCA
tRNAPhe#AAGeobacillus stearothermophilusprokaryotic cytosol -GGCUCGG4AGCUCAGUC-GGD--AGAGCAAAGGACU#AA*APCCUUGU-------------------7UCGGCGGTPCGAUUCCGUCCCGAGCCACCA
tRNALeuBAAGeobacillus stearothermophilusprokaryotic cytosol -GCCGAUG4GGCGGAAUD-GGCA-G"CGCGCACGACUBAA*APCGUGU-GGGC---UUU-----GCCCG-UGUGGGTPCGACUCCCACCAUCGGCACCA
tRNAValGACGeobacillus stearothermophilusprokaryotic cytosol -GAUUCCGUAGCUCAGCD-GGG--AGAGCGCCACCUUGAC=GGGUGGAG-------------------7UCGCUGGTPCGAGCCCAGUCGGAAUCACCA
tRNATyrQUAGeobacillus stearothermophilusprokaryotic cytosol -GGAGGGG4AGCGAAGU--#GCUAA"CGCGGCGGACUQUA*APCCGCU-CCC----UUU------GGGUUCGGCGGTPCGAAUCCGUCCCCCUCCACCA
tRNAIniCAUMycobacterium smegmatisprokaryotic cytosol -CGCGGGGUGGAGCAGCUCGGD--AGCUCGCUGGGCUCAUAACCCAGAG-------------------7UCGCAGGUPCG"AUCCUGUCCCCGCUACCA
tRNAAlaUGCMycoplasma capricolumprokaryotic cytosol -GGGCCCU4AGCUCAGCD-GGG--AGAGCACCUGCCUUGC=CGCAGGGG-------------------7UCGACGGUPCGAUCCCGUUAGGGUCCACCA
tRNAArgICGMycoplasma capricolumprokaryotic cytosol -GCGCCCG4AGAUCAAUD-GGAD-AGAUCGCUUGACUICGKAPCAAAAG-------------------7UUGGGGGUPCGAGUCCCUCCGGGCGCACCA
tRNAArg!CUMycoplasma capricolumprokaryotic cytosol -GCCCAUGUAGCUCAGUA-GGAD-AGAGCACGCGCCU!CU6AGCGUGAG-------------------7UCGGAAGUPCGAGCCUUCUCGUGGGCACCA
tRNAAsnGUUMycoplasma capricolumprokaryotic cytosol -GGCUUUU4AGCUCAGCA-GGD--AGAGCAACCGGCUGUU6ACCGGUUU-------------------7UCACAGGUPCGAGCCCUGUAAAAGCCGCCA
tRNAAspGUCMycoplasma capricolumprokaryotic cytosol -GGCCCCA4AGCGAAGUD-GGDD-AUCGCGCCUCCCUGUCACGGAGGAG-------------------AUCACGGGUPCGAGUCCCGUUGGGGUCGCCA
tRNACysGCAMycoplasma capricolumprokaryotic cytosol -GGCAACA4GGCCAAGC--GGCD-A"GGCAUGGGUCUGCA=CACCCUGA-------------------U-CAUCGGUPCGAAUCCGAUUGUUGCCUCCA
tRNAGln$UGMycoplasma capricolumprokaryotic cytosol -UGGGCUA4AGCCAAGC--GGD--A"GGCAAGGGACU$UG=CUCCCUCA-------------------UGCGCCGGUPCGAAUCCUGCUAGCCCAACCA
tRNAGlu$UCMycoplasma capricolumprokaryotic cytosol -GGCCUGUUGGUGAAGC--GGDD-A"CACACACGGUU$UCAUCCGUGGA-------------------CACACGGGUPCGAACCCCGUACAGGCUACCA
tRNAGly{CCMycoplasma capricolumprokaryotic cytosol -GCAGGUG4AGUUUAAU--GGD--AGAACUUCAGCCUUCC=AGCUGAUU-------------------G-UGAGGGUPCGAUUCCCUUCACCUGCUCCA
tRNAHisGUKMycoplasma capricolumprokaryotic cytosol GGCGUAGGUGGUGAAGU--GGDD-A"CACAUCAGGUUGUGKCPCUGACA-------------------UACGCGGGUPCGAUCCCCGUUCUACGCCCCA
tRNAIle}AUMycoplasma capricolumprokaryotic cytosol -GGACCUU4AGCUCAGUD-GGDD-AGAGCAUCCGGCU}AU=ACCGGACG-------------------7UCAUUGGUPCAAGUCCAAUAAGGUCCACCA
tRNAIleGAUMycoplasma capricolumprokaryotic cytosol -CGGAAUAUAGCUCAGCD-GGDD-AGAGCAUUCCGCUGAU6ACGGAGAG-------------------7UCGUUGGUPCAAGUCCAAUUAUUCCGACCA
tRNALeuBAAMycoplasma capricolumprokaryotic cytosol -GCCUUUUUGGCGGAAUD-GGCA-G"CGCAUUAGACUBAA=APCUAACGAA-----GAAA------UUCGUAUCGGUPCGAAUCCGAUAAAGGGCACCA
tRNALeu)AAMycoplasma capricolumprokaryotic cytosol -CCCCAAG4GGCGGAAUA-GGDA-G"CGCAUUGGACU)AA=APCCAACGGGC----UUAAU---AUCCUGUGCCGGUPCAAGUCCGGCCUUGGGGACCA
tRNALeuUAGMycoplasma capricolumprokaryotic cytosol -GGGGGAU4GGCGGAAUD-GGCA-G"CGCACUAGACUUAGKAPCUAGCGUC-----UUU-------GACGUAAGGGUPCAAGUCCCUUAUCCCCCACCA
tRNALysCUUMycoplasma capricolumprokaryotic cytosol -GUCUGAUUAGCGCAACD-GGC--AGAGCAACUGACUCUU6APCAGUGG-------------------7UUGUGGGUPCGAUUCCCACAUCAGGCACCA
tRNALys$UUMycoplasma capricolumprokaryotic cytosol -GACUCGUUAGCUCAGCC-GGD--AGAGCAACUGGCU$UU6ACCAGUGG-------------------7UCCGGGGUPCGAAUCCCCGACGAGUCACCA
tRNAMetCAUMycoplasma capricolumprokaryotic cytosol -GGCGGGG4AGCUCAGUD-GGDD-AGAGCGUUCGGUUCAUACCCGAAAG-------------------7UCGAGAGUPCAAAUCUCUCCCCCGCUACCA
tRNAPheGAAMycoplasma capricolumprokaryotic cytosol -GGUCGUGUAGCUCAGUC-GGD--AGAGCAGCAGACUGAAKCPCUGCGU-------------------7UCGGCGGUPCAAUUCCGUCCACGACCACCA
tRNAProUGGMycoplasma capricolumprokaryotic cytosol -CGGGAAGUGGCUCAGUUUGGD--AGAGCAUUCGGUUUGGKACCGAAGG-------------------7UCGCAGGUPCAAAUCCUGUCUUCCCGACCA
tRNASerGCUMycoplasma capricolumprokaryotic cytosol -GGGUUAA4ACUCAAGUD-GGDG-A"GAGGACACCCUGCU6AGGUGUUAGGUCGG-UCU-----CCGGCGCGAGGGUPCGAGUCCCUCUUAACCCGCCA
tRNASerUGAMycoplasma capricolumprokaryotic cytosol -GGAAGAU4ACCCAAGUCCGGCDGA"GGGAUCGGUCUUGA=AACCGAGAGUCGG--GGAAA----CCGAGCGGGGGUPCGAAUCCCUCAUCUUCCGCCA
tRNAThrAGUMycoplasma capricolumprokaryotic cytosol -GCUGACU4AGCUCAGUD-GGD--AGAGCAAUUGACUAGU6APCAAUAG-------------------7UCGAAGGUPCAAAUCCUUUAGUCAGCACCA
tRNAThrUGUMycoplasma capricolumprokaryotic cytosol -GCUGACU4AGCUCAGCA-GGC--AGAGCAACUGACUUGU6APCAGUAG-------------------7UCGUAGGUPCGAUUCCUAUAGUCAGCACCA
tRNATrpBCAMycoplasma capricolumprokaryotic cytosol -AGGAGAGUAGUUCAAU--GGD--AGAACGUCGGUCUBCA=AACCGAGC-------------------7UUGAGGGUPCGAUUCCUUUCUCUCCUGCCA
tRNATrp)CAMycoplasma capricolumprokaryotic cytosol -AGGGGCAUAGUUCAGUA-GGD--AGAACAUCGGUCU)CA=AACCGAGU-------------------7UCACGAGUPCGAGUCUUGUUGCCCCUGCCA
tRNATyrGUAMycoplasma capricolumprokaryotic cytosol -GGAGGGGUAGCGAAGU--GGCDAA"CGCGGGUGGCUGUA=CCCACUUCC------UUAC------GGUUCGGGGGUPCGAAUCCCUCCCCCUCCACCA
tRNAValUACMycoplasma capricolumprokaryotic cytosol -GGAGUGUUAGCUCAGCD-GGG--AGAGCUCCUGCCUUAC=AGCAGGCG-------------------7UCAUAGGUPCAAGUCCUAUACACUCCACCA
tRNAIniCAUMycoplasma capricolumprokaryotic cytosol -CGCGGGGUAGAGCAGUD-GGD--AGCUCGCCGGGCUCAUAACCCGGAG-------------------GUCGCAGGUPCGAGUCCUGCCCCCGCAACCA
tRNAAlaUGCMycoplasma mycoidesprokaryotic cytosol -GGGCCCUUAGCUCAGCD-GGG--AGAGCACCUGCCUUGC=CGCAGGGG-------------------7UCGACGGUUCGAUCCCGUUAGGGUCCACCA
tRNAGly{CCMycoplasma mycoidesprokaryotic cytosol -GCAGGUG4AGUUUAAU--GGC--AGAACUUCAGCCUUCC=AGCUGAUU-------------------G-UGAGGGUPCGAUUCCCUUCACCUGCUCCA
tRNAIleGAUMycoplasma mycoidesprokaryotic cytosol -CGGAAUA4AGCUCAGCD-GGDD-AGAGCAUUCCGCUGAU6ACGGAGAG-------------------7UCGUUGGUPCAAGUCCAAUUAUUCCGACCA
tRNAProUGGMycoplasma mycoidesprokaryotic cytosol -CGGGAAGUGGCUCAGUUUGGD--AGAGCAUUCGGUUUGGKACCGAAGG-------------------GUCGCAGGUUCAAAUCCUGUCUUCCCGACCA
tRNASerUGAMycoplasma mycoidesprokaryotic cytosol -GGAAGAUUACCCAAGUCCGGCDGA"GGGAUCGGUCUUGA=AACCGAGAGUCGGG-GAAA--CCCGAG--CGGGGGUUCGAAUCCCUCAUCUUCCGCCA
tRNAThrUGUMycoplasma mycoidesprokaryotic cytosol -GCUGACUUAGCUCAGCA-GGC--AGAGCAACUGACUUGUHAPCAGUAG-------------------7UCGUAGGUUCGAUUCCUAUAGUCAGCACCA
tRNAValUACMycoplasma mycoidesprokaryotic cytosol -GGAGUGU4AGCUCAGCD-GGG--AGAGCUCCUGCCUUAC=AGCAGGCG-------------------GUCAUAGGUUCAAGUCCUAUACACUCCACCA
tRNAIniCAUMycoplasma mycoidesprokaryotic cytosol -CGCGGGG4AGAGCAGUD-GGD--AGCUCGCCGGGCUCAUAACCCGGAG-------------------GCCGCAGGUPCGAGUCCUGCCCCCGCAACCA
tRNAPheGAARhodospirillum rubrumprokaryotic cytosol -GCCCGGGUAGCUCAGCD-GGD--AGAGCACGUGACUGAA*APCACGGU-------------------7UCGGUGGTPCGACUCCGCCCCCGGGCACCA
tRNALeuCAARhodospirillum rubrumprokaryotic cytosol -GCCUUUGUAGCGGAAD--GGD--AACGCGGCAGACUCAAHAPCUGCU-UUGG---UAAC----CCAGG-UGGUAGTPCGACUCUCCCCAAAGGCACCA
tRNAGlyCCCSalmonella typhimuriumprokaryotic cytosol -GCGGGCGUAGUUCAAU--#GD--AGAACGAGAGCUUCCCAAGCUCUAU-------------------A-CGAGGGTPCGAUUCCCUUCGCCCGCUCCA
tRNAGlyNCCSalmonella typhimuriumprokaryotic cytosol -GCGGGCAUCGUAUAAU--GGCU-AUUACCUCAGCCUNCCAAGCUGAUG-------------------A-UGCGGGTPCGAUUCCCGCUGCCCGCUCCA
tRNAHisQUGSalmonella typhimuriumprokaryotic cytosol GGUGGCUA4AGCUCAGDD-GGD--AGAGCCCUGGAUUQUG/PPCCAGUU-------------------7UCGUGGGTPCGAAUCCCAUUAGCCACCCCA
tRNALeuCAGSalmonella typhimuriumprokaryotic cytosol -GCGAAGGUGGCGGAADD-#GDA-GACGCGCUAGCUUCAG;PGPUAGU-GUCC---UUAC----GGACG-UGGGGGTPCAAGUCCCCCCCCUCGCACCA
tRNAProCGGSalmonella typhimuriumprokaryotic cytosol -CGGUGAU4GGCGCAGCCUGGD--AGCGCACUUCGJUCGGKACGAAGGG-------------------7UCGGAGGTPCGAAUCCUCUAUCACCGACCA
tRNAProGGGSalmonella typhimuriumprokaryotic cytosol -CGGCACG4AGCGCAGCCUGGD--AGCGCACCGUCBUGGGKUPGCGGGG-------------------7UCGGAGGTPCAAAUCCUCUCGUGCCGACCA
tRNAProVGGSalmonella typhimuriumprokaryotic cytosol -CGGCGAG4AGCGCAGCUUGGD--AGCGCAACUGGJUVGGKACCAGUGG-------------------7UCGGAGGTPCGAAUCCUCPCUCGCCGACCA
tRNATrpNCASpiroplasma citriprokaryotic cytosol -AGGGGUAUAGUUCAAUC-GGU--AGAACACCGGACUNCAHAPCCGGGU-------------------7UUGUGGGUPCAAGUCCUGCUACCCCUGCCA
tRNATrpCCASpiroplasma citriprokaryotic cytosol -AGGGGUGUAGUUUAAU--GGU--AGAACAGCGGUCUCCAHCACCGUAC-------------------GUUGUGGGUPCAAGUCCUGUCACCCCUGCCA
tRNAGly{CCStaphylococcus epidermidisprokaryotic cytosol -GCGGGAG4AUUUCAACU-UUD--AGAAUACGUUCCUUCCCGGAACGAG-------------------A-UAUAGGUGCAAAUCCUAUCUUCCGCUCCA
tRNAGly{CCStaphylococcus epidermidisprokaryotic cytosol -GCGGGAG4AGUUCAAU--UUD--AGAACACAUUCCUUCCCGGAAUGAG-------------------G-UAUAGGUGCAAGUCCUAUCUUCCGCUCCA
tRNAGlyCCCStreptomyces coelicolor A3(2)prokaryotic cytosol -GCGGGUGUAGUUCAAU--GGD--AGAACAUCAGCUUCCCAAGCUGAGA-------------------G-CGCGAGTPCGAUUCUCGUCACCCGCUCCA
tRNAIniCAUStreptomyces griseusprokaryotic cytosol -CGCGGGGUGGAGCAGCUCGGD--AGCUCGCUGGGCUCAUAACCCAGAG-------------------GUCGCAGGUPCA"AUCCUGUCCCCGCUACCA
tRNALeuCAASynechococcus elongatus PCC 6301prokaryotic cytosol -GGGCAAGUGGCGGAAUD-GGDA-GACGCAGCAGACUCAAHAPCUGCC-GCUA---GCGA----UAGUG-UGUGGGTPCGAGUCCCACCUUGCCCACCA
tRNALeuCAGSynechococcus elongatus PCC 6301prokaryotic cytosol -GCGGAACUGGCGGAAUD-GGDA-GACGCGCUAGAUUCAGKPPCUAGU-GGUU---UCAC----GACUG-UCCGGGTPCAAGUCCCGGGUUCCGCACCA
tRNAIniCAUSynechococcus elongatus PCC 6301prokaryotic cytosol -CGCGGGGUAGAGCAGCCUGGD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCAGAGGTPCAAAUCCUCUCCCCGCCACCA
tRNAPheGAASynechococcus sp. PCC 7002prokaryotic cytosol -GCCAGGAUAGCNCAGUD-#GD--AGAGCAGAGGACUGAA*APCCUCGU-------------------7UCGGCGGTPCAAUUCCGCCUCCCGGCACCA
tRNAGluNUCSynechocystis sp.prokaryotic cytosol -GCCCCCAUCGUCUAGA--GGCCDAGGACACCUCCCUNUCACGGAGGCG-------------------A-CAGGGATPCGAAUUCCCUUGGGGGUACCA
tRNAAspGUCThermus thermophilusprokaryotic cytosol -GGCCCCG4GGUGPAGUU-#GDD-AACACACCCGCCUGUCACGPGGGAG-------------------AUCGCGGGFPCG"GUCCCGUCGGGGCCGCCA
tRNAPheGAAThermus thermophilusprokaryotic cytosol -GCCGALG4AGCUCAGUU-#GD--AGAGCAUGCGACUGAA+APCGCAGU-------------------7UCGGCGGTPCGAUUCCGCUCCUCGGCACCA
tRNAIleGAUThermus thermophilusprokaryotic cytosol -GGGCGAUUAGCUCAGCU-#GUD-AGAGCGCACGCCUGAU6AGCGUGAG-------------------7UCGGUGGFPCA"GUCCACCAUCGCCCACCA
tRNAMetCAUThermus thermophilusprokaryotic cytosol -CGCGGGG4GGAGCAGCCU#GD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGCGGGFPCA"AUCCCGCCCCCGCAACCA
tRNAIniCAUThermus thermophilusprokaryotic cytosol -CGCGGGG4GGAGCAGCCU#GD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGCCGGFPCA"AUCCGGCCCCCGCAACCA
tRNAIniCAUThermus thermophilusprokaryotic cytosol -CGCGGGG4GGAGCAGCCU#GD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGCGGGFPCA"AUCCCGCCCCCGCAACCA
tRNAAlaCGCHalobacterium salinarumprokaryotic cytosol -GGGCUCGUAGAUCAGC--GGU--AGAUCRCUUCCUUCGCAAGGAAGAG-------------------GCC?UGGG]PBOAAUCCCAGCGAGUCCACCA
tRNAGlyGCCHalobacterium salinarumprokaryotic cytosol -GCGCUGGUALUGPAGU--GGU--AUCACGUGACCUUGCCAUGGUCACA-------------------A-??UGGG]PBOAAUCCCAGCCAGCGCACCA
tRNAHisGUGHalobacterium salinarumprokaryotic cytosol GUCCGGGCU.RGGPAGU--GGACUAUCCUUCAGCCUUGUGKAGGCUGAG-------------------A-CGCGGG]PBGAUUCUCGCGCCUGGACCCA
tRNAAsnGUUHalobacterium salinarumprokaryotic cytosol -GCCGCCAUAGCUCAGUU-GGU--AGAGCACGUGGUUGUU6CCCACGUU-------------------GU?CCAGG]PBGGACCCUGGUGGCGGCGAAC
tRNAGlnCUGHalobacterium salinarumprokaryotic cytosol -AGUCCCGU.RGGPAGU--GGCCAAUCCUGAAGCCUUCUGKGGGCUUCG-------------------A-CGGAAGPPBGAAUCUUCCCGGGACUACCA
tRNAArgGCGHalobacterium salinarumprokaryotic cytosol -GUCCGGAUARGGPAGU--GGACUAUCCUCUUGGCUUGCGKAGCCAGGG-------------------A-CCGG?G]PBOAAUCGCCGUCCGGACGCCA
tRNASerMGAHalobacterium salinarumprokaryotic cytosol -GCCGAGGUAGCAPA(CUUGGCC-AAUGCRGUUGCUUMGAKAGCAACG-UUCC---ACAC----GGACU-?AGGAG]PBOAAUCUCCUCCUCGGCGCCA
tRNAThrGGUHalobacterium salinarumprokaryotic cytosol -GCCUGGGUAGCUPAGC--GGU--AAAGCRCGUCCUUGGU6AGGACGAG-------------------ACC??GGA]PBOAAUUCCGGCCUAGGCUCCA
tRNAValCACHalobacterium salinarumprokaryotic cytosol -GGGUCGGUKGUCPAGUCCGGUU-AUGACGGCUCCUUCACACGGAGCAG-------------------GUCGG?GG]PBOACUCCGCCCCGACCCACCA
tRNAValCACHalobacterium salinarumprokaryotic cytosol -GGGUUGGUKGUCPAGUCAGGCU-AUGACACCUCCUUCACAUGGAGGAG-------------------GUCGG?GG]PBOAAUCCGCCCCAACCCACCA
tRNAValGACHalobacterium salinarumprokaryotic cytosol -GGGUUGGUGGUCPAGUCAGGCU-AUGACACCUCCUUGACAUGGAGGAG-------------------GUCGG?GG]PBOAAUCCGCCCCAACCCACCA
tRNAIniCAUHalobacterium salinarumprokaryotic cytosol -AGCGGGAUGGGAPA(CUAGGAG-AUUCCGCCGGGCUCAUAACCCGGAG-------------------AUCGGUAG]PBOAAUCUACCUCCCGCUACCA
tRNAIniCAUHalococcus morrhuaeprokaryotic cytosol -AGCGGGAUGGGAPAGCCAGGAG-AUUCCLGCGGGCUCAUAACCCGCAG-------------------AUCAGUAG]PBOAAUCUACUUCCCGCUACCA
tRNAAlaCGCHaloferax volcaniiprokaryotic cytosol -GGGCUCGUAGAUCAGU--GGC--AGAUCRCUUCCUUCGCAAGGAAGAG-------------------GC??GGGG]PBOAAUCCCCGCGAGUCCACCA
tRNAAlaGGCHaloferax volcaniiprokaryotic cytosol -GGGCUCGUAGAUCAGG--GGU--AGAUCACUCCCUUGGCAUGGGAGAG-------------------GC??CGGG]PBOAAUCCCGGCGAGUCCACCA
tRNAAlaUGCHaloferax volcaniiprokaryotic cytosol -GGGCCCAUAGCUCAGU--GGU--AGAGULCCUCCUUUGCAAGGAGGAU-------------------GC??AGGG]PBGAAUCCCUGUGGGUCCACCA
tRNACysGCAHaloferax volcaniiprokaryotic cytosol -GCCAAGGUGGCAGA(UUCGGCCCAACGCAUCCGCCUGCAKAGCGGAAC-------------------C_?GCCGG]PBOAAUCCGGCCCUUGGCUCCA
tRNAAspGUCHaloferax volcaniiprokaryotic cytosol -GCCCGGGUGRUGPAGU--GGCCCAUCAUACGACCCUGUCACGGUCGUG-------------------A-CGCGGG]PBOAAUCCCGCCUCGGGCGCCA
tRNAGluMUCHaloferax volcaniiprokaryotic cytosol -GCUCUGUUGRUGPAGUCCGGCCAAUCAUAUCACCCUMUCACGGUGAUG-------------------A-C?AGGG]PBGAAUCCCUGACGGAGCACCA
tRNAGluNUCHaloferax volcaniiprokaryotic cytosol -GCUCGGUUGRUGPAGUCCGGCCAAUCAUCUUGGCCUNUCKAGCCGAGG-------------------A-C?AGGG]PBOAAUCCCUGACCGAGCACCA
tRNAPheGAAHaloferax volcaniiprokaryotic cytosol -GCCGCCUUAGCUCA(ACUGGG--AGAGCACUCGACUGAAKAPCGAGCU-------------------GU?CCCGG]PBOAAUCCGGGAGGCGGCACCA
tRNAGlyCCCHaloferax volcaniiprokaryotic cytosol -GCGCCGAUGLUCCAGU--GGU--AGGACACGAGCUUCCCAAGCUCGGA-------------------G-C?CGGG]PBOAUUCCCGGUCGGCGCACCA
tRNAGlyGCCHaloferax volcaniiprokaryotic cytosol -GCGUCGGUALUGPAGU--GGU--AUCACGUGACCUUGCCAUGGUCACA-------------------A-C?UGGG]PBOAAUCCCAGCCGACGCACCA
tRNAGlyGCCHaloferax volcaniiprokaryotic cytosol -GCGCUGGUALUGPAGU--GGU--AUCACGUGACCUUGCCAUGGUCACA-------------------A-C?UGGG]PBOAAUCCCAGCCAGCGCACCA
tRNAGlyNCCHaloferax volcaniiprokaryotic cytosol -GCACCGGUGLUCUAAU--GGU--AAGACAUUGGCCUNCCAAGCCAAUU-------------------A-U?UGGG]PBGAUUCCCAGCCGGUGCACCA
tRNAHisGUGHaloferax volcaniiprokaryotic cytosol GUCCGGGUUGRGGPAGU--GGACUAUCCUUCAGCCUUGUGKAGGCUGAG-------------------A-CGCGGGPPBAAUUCUCGCACCUGGACCCA
tRNAIleGAUHaloferax volcaniiprokaryotic cytosol -GGGCCAAUAGCUCAGUCAGGUU--GAGCRCPCGGCUGAU6AC?GGGAG-------------------GCC?GCGG]PBOAAUCCGCGUUGGCCCACCA
tRNAIleNAUHaloferax volcaniiprokaryotic cytosol -GGGCCCCUAGCUCA(UCUGGUC-AGAGCRCUCGGCUNAU6ACCGGGUG-------------------GU?AUGGG]PBGAACCCCAUGGGGCCCACCA
tRNALysNUUHaloferax volcaniiprokaryotic cytosol -GGGCUGGUAGCUCA(UUAGGC--AGAGCRUCUGGBUNUU6ACCAGACG-------------------GU?GGGGG]PBOAGUCCCUCCCAGCCCGCCA
tRNALysMUUHaloferax volcaniiprokaryotic cytosol -GGGCCGGUAGCUCA(UUAGGC--AGAGCRUCUGABUMUU6APCAGACG-------------------GU?GCGPG]PBOAAUCGCGUCCGGCCCACCA
tRNALeuCAAHaloferax volcaniiprokaryotic cytosol -GCGAGGGUAGCUAA(UCAGGAA-AAAGCRGCGGACUCAAKAPCCGCU-CCC----GUAG-----GGGUC?GUGGG]PBOAAUCCCUCCCCUCGCACCA
tRNALeuCAGHaloferax volcaniiprokaryotic cytosol -GCAGGGAUAGCCAA(UCUGGCCAACGGCRCAGCGUUCAGKGCGCUGU-CUC----AUAG-----GAGUC?GCAGG]PBOAAUCCUGCUCCCUGCACCA
tRNALeuGAGHaloferax volcaniiprokaryotic cytosol -GCGUGGGUAGCCAA(CCAGGCCAACGGCRCAGCGUUGAGKG?GCUGU-CCU----GUAG-----AGGUC?GCCGG]PBOAAUCCGGUCCCACGCACCA
tRNALeuUAAHaloferax volcaniiprokaryotic cytosol -GCGGGGGUGGCUGA(CCAGGCCAAAAGCLGCGGACUUAAKAPCCGCU-CCC----GUAG-----GGGUUCGCGAG]PBGAAUCUCGUCCCCCGCACCA
tRNALeu5AGHaloferax volcaniiprokaryotic cytosol -GCGCGGGUAGCCAA(U--GGCCAAAGGCRCAGCGCU5AGKACGCUGU-GGU----GUAG-----ACCUU?GCAGG]PBGAACCCUGUCCCGCGCACCA
tRNAMetBAUHaloferax volcaniiprokaryotic cytosol -GCCCGGGUGGCUPA(CU-GGAC-APAGCGCCGCACUBAU6APGCGGAG-------------------AU?GUGGG]PBGGAGCCCACCCCGGGCACCA
tRNAAsnGUUHaloferax volcaniiprokaryotic cytosol -GCCGCCGUAGCUCA(UU-GGU--AGAGCACCUCGCUGUU6ACGAGGUU-------------------GU??CAGG]PBGAGUCCUGGCGGUGGCGCCA
tRNAProMGGHaloferax volcaniiprokaryotic cytosol -GGGCCGGUGRGGPA(CUUGGU--AUCCUUCGGCCUUMGGKPGGCCGUA-------------------A-??UCAG]PBGAAUCUGAGCCGGCCCACCA
tRNAProGGGHaloferax volcaniiprokaryotic cytosol -GGGACCGUGRGGPAGU--GGU--AUCCUCUGCCGAUGGGKUCGGUAGG-------------------A-C?UGAG]PBGACUCUCAGCGGUCCCACCA
tRNAProUGGHaloferax volcaniiprokaryotic cytosol -GGGACCGUGRGUPA(CCUGGU--AUACUUCGGGCCUUGGKUGCCCGUG-------------------A-??CCGG]PBOAAUCCGGGCGGUCCCACCA
tRNAGlnMUGHaloferax volcaniiprokaryotic cytosol -AGUCCCAUGRGGPAGU--GGCCAAUCCUGUUGCCUUMUGKGGGCAACG-------------------A-CCCAGGPPBGAAUCCUGGUGGGACUACCA
tRNAArgCCGHaloferax volcaniiprokaryotic cytosol -GGGCCCGUAGCUCA(U--GGAC-AGAGURCUUGGUUCCGKACCAAGAU-------------------GC?GCGGG]PBOAAUCCCGUCGGGUCCGCCA
tRNAArgGCGHaloferax volcaniiprokaryotic cytosol -GUCCUGAUARGGPAGU--GGACUAUCCUCCUGGCUUGCGKAGCCAGGG-------------------A-C?GGAG]PBOAAUCUCCGUCAGGACGCCA
tRNAArgNCGHaloferax volcaniiprokaryotic cytosol -GGGCGCUUAGCUCA(UCUGGAC-AGAGULCUUGGCUNCGKACCAAGUU-------------------GC?ACGGG]PBOAAUCCUGUAGCGCCCACCA
tRNASerGCUHaloferax volcaniiprokaryotic cytosol -GUUGCGGUAGCCAA(CCUGGCCCAAGGCRCUGGGUUGCU6ACUCAGU-GGC----GUCAA----GCCC-??GGGG]PBGAAUCCCCGCCGCAACGCCA
tRNASerMGAHaloferax volcaniiprokaryotic cytosol -GCCGAGGUAGCCPA(CCCGGCC-AAGGCRGUAGAUUMGAAAPCUACU-GUCC---AUUC----GGACA-?GUGAG]PBOAAUCUCACCCUCGGCGCCA
tRNASerGGAHaloferax volcaniiprokaryotic cytosol -GCCAGGAUGGCCGA(C--GGU--AAGGCRCACGCCUGGAAAGCGUGU-UCCC---UCU-----GGGAU-?GGGGG]PBOAAUCCCUCUCCUGGCGCCA
tRNAThrCGUHaloferax volcaniiprokaryotic cytosol -GCCGGUGUAGCUCA(UU-GGC--AGAGCRAUUCCUUCGU6AGGAAUAG-------------------GC?GAGGG]PBOAAUCCCUCCACCGGCUCCA
tRNAThrGGUHaloferax volcaniiprokaryotic cytosol -GCCUGGGUAGCUPA(C--GGU--AAAGCRCGUCCUUGGU6AGGACGAG-------------------AC??CGGG]PBOAAUCCCGGCCUAGGCUCCA
tRNAValCACHaloferax volcaniiprokaryotic cytosol -GGGUUGGUGGUCPA(CCAGGUU-AUGACGGCUCCUUCACACGGAGCAG-------------------GC?GGCGG]PBGAAUCCGCCCCAACCCACCA
tRNAValGACHaloferax volcaniiprokaryotic cytosol -GGGUUGGUGGUCPAGUCUGGUU-AUGACACCUCCUUGACAUGGAGGAG-------------------GC?GGCAG]PBOAAUCUGCCCCAACCCACCA
tRNATrpBCAHaloferax volcaniiprokaryotic cytosol -GGGGCUGUGGCCAA(CCCGGC--AUGGCRACUGABUBCAKAJCAGUCG-------------------AU?GGGGG]PBOAAUCCCUCCGGCCCCACCA
tRNAIniCAUHaloferax volcaniiprokaryotic cytosol -AGCGGGAUGGGAPA(CCAGGAG-AUUCCGCCGGGCUCAUAACCCGGAG-------------------AUCGGUAG]PBOAAUCUACCUCCCGCUACCA
tRNATyrGUAHaloferax volcaniiprokaryotic cytosol -CCGCUCUUAGCUCA(CCUGGC--AGAGCAGCCGABUGUAKAPCGGCUU-------------------GU?CCCCG]PBOAAUCGGGGAGAGCGGACCA
tRNAGlyGCCMethanobacterium thermaggregansprokaryotic cytosol -GCGGCGUUAGUCCA;CU-GGU-UAAGACACUGGCCUGCCACGCCAGCG-------------------U-CCCGGGPPBOAAUCCCGGACGCCGCACCA
tRNAAsn;UUMethanobacterium thermaggregansprokaryotic cytosol -GCGCCGGUGGCUCA;CCUGGUU-AGAGCUCACGGCU;UU6ACCGUGAG-------------------GCCGCGGGPPBOAAUCCCGCCCGGCGCACCA
tRNAPyrCUAMethanosarcina barkeriprokaryotic cytosol -GGAAACC4-GAUCA-U--G-U--AGAUCG_UGGACUCUAAAUCCG_CA---------------------GCCGGG]UAGAUUCCCGGGGUUUCCGCCA
tRNAIniCAUSulfolobus acidocaldariusprokaryotic cytosol -AGCGGCGU.LGGAACUG-GGAGUAUCCC|CA#GGBUCAUAACCCUGAG-------------------GU?CCUGGJUBO"AUCCAGGCGCCGCUACCA
tRNAMetCAUThermoplasma acidophilumprokaryotic cytosol -GCCGGGG4GGCUCA(CU-GGA--GGAGCRCCGGABUCAU6AUCCGGAG-------------------GUCUCGGGPPBGAUCCCCGAUCCCGGCACCA
tRNAIniCAUThermoplasma acidophilumprokaryotic cytosol -AGCGGGGUGGGGPAGUCAGGA--AAUCCLAUGGGBUCAUAACCCGUAG-------------------AUCGAUGGPPBH"AUCCAUCCCCCGCUACCA
tRNALeu&AGThermoplasma acidophilumprokaryotic cytosol -GCGGAGG44GUC(A(ACUGGCCAAAGGCRAUGGAUU&AGKGPCCAUUCCCG-----AAG-----GGGUUC7AGGGPPBA"AUCCCUCCCUCCGCACCA
tRNAAspGUCAedes albopictusmitochondrial -AAAAAAUU"GUUUAAU--CA---AAAACCPPAGUAUGUC6AACUAAAA-------------------A-AAUUAGAUCAU--CUAAUAPPUUUUACCA
tRNAGluNUCAedes albopictusmitochondrial -AUUUAUAU"GUUUAA---AU---AAAACAPPACAUUNUC6CUGUAAAA-------------------A-UAAAA-AUUUAU--UUUUPAUAAAUACCA
tRNAGlyUCCAedes albopictusmitochondrial -AUUUAUAU"GUAUAUA--AU---UGUAUAPGN;ACUUCCAA]CACAAG-------------------G-ACUAA-AUAAUU--UUAGUAPAAAUACCA
tRNAIleGAUAedes albopictusmitochondrial -AAUGAAUUKCCUGAU---AA---AAAGGAPPACCUUGAU6GGGUAAAU-------------------UAUAAAGAUUUAAU-ACUUPAPUCAUUACCA
tRNALysCUUAedes albopictusmitochondrial -CAUUAGAUKACUGAA---AG---CAAGUAAPGAUCUCUU6AAUCAUAA-------------------UAUAGUAAAUUAGC_UUACPPCUAAUGACCA
tRNAGlnNUGAedes albopictusmitochondrial -UAUAUUUU"GUGUAU---GA---UGCACAAAAGPUUNUGAAACUUUUA-------------------G-AAAUAGUUUAAUUCUAUUAAAUAUAACCA
tRNASerGCUAedes albopictusmitochondrial -GAAAUAU--GUU-----GA--UC--AAG-AAAAGCUGCU6ABUPUUUCUU------------------UAAUGGUUUAAUUCCAUPAUAUUUCU-CCA
tRNAValUACAedes albopictusmitochondrial -CAAUUUAA"LCUUAAUU-AGU--AAAGUAPPUCAUUUAC6PPGAAAAG-------------------A-AAUUUGUGCAAAUCAAUPPAAAUUGACCA
tRNAIniCAUAedes albopictusmitochondrial -AAAAAGAU"AGCUAA---UU---AAGCUAPPGGGUUCAU6CCCCACUU-------------------A-UAAAGGUAAUAAUCCUUPPCUUUUUACCA
tRNAPheGAAAscaris suummitochondrial -ACUCUGUU"GUUUAUGU-UUU--AAAAPAPGACPPUGAAKAAGUUGGA-------------------A-AA----UG---------UUAGGAGUGCCA
tRNAMet>AUAscaris suummitochondrial -AAPAAGAU"GGAUAA---GUUG-AGUCULPGAGGUU>AUACCCUCUUG-------------------G-UG----UUUUU------CUCUUAPUGCCA
tRNAArgACGAscaris suummitochondrial -GGACGUU""AUAGAU---AA---GCUAPGCCPAGPUACGKPCPGGGAA-------------------G-AG---------------AGUCGPCUUCCA
tRNASerUCUAscaris suummitochondrial -GACAAAUG-----------------UUUPCAGGUCUUCU6AAPCUGUUUU--------------------GGA--GAAA-----UCCGPUUGUUUCCA
tRNAGlu!UCAscaris suummitochondrial -GAGAUAUU"GUAUAAAUUUUU--UGUAPAPUPCUPU!UCKAAGAAAAG-------------------G-U-----UUA---------UUAUCPUACCA
tRNALys!UUAscaris suummitochondrial -GGGGUGUU"ACUUAAGUUU----AAAGPRPPAGAUU!UU6APCUGGAA-------------------A-UGG---GUUG------UCACAPCCUGCCA
tRNAGln!UGAscaris suummitochondrial -UAUACUUU"GUUUAGGA------AGAAUAPUUAPPU!UGKPGPAAAAG-------------------G-G-----UUG---------UAGUAPAGCCA
tRNATrp$CAAscaris suummitochondrial -ACAGAUUU"AGUUAAGUUU----AAACUCPPGGPPU$CA*AACCAAAA-------------------A-U-----UUU---------ACUCPGUACCA
tRNALeu$AAAscaris suummitochondrial -GPUGUUAU"GCAUAAGA------AGUGCAPPUGPPU$AAKCGPAAAAG-------------------A-U-----AUG---------GGACAACUCCA
tRNAAspQUCAsterias amurensismitochondrial -AAGAAACU"GUUAAACUA-----AUAACACUGGAUUQUCAGACCGGAG--------------------UAACUGGUAAACAAUCAGUGUUUCUUGCCA
tRNAHisQUGAsterias amurensismitochondrial GACUAAAGU"GUUUAAAU------AAAACCCPAAUPUQUGKPAUUAAAA--------------------UUAUCAGUPAA"AUCUGAUCUAUAGUCCCA
tRNALysCUUAsterias amurensismitochondrial -CUUUGAUA"GCUUAUAAUGG---CAAGCAPUAAACUCUU6APUUAAAU-------------------CAAAGUGAUCUCACCACACUAUCAAAGACCA
tRNAAsnGUUAsterias amurensismitochondrial -UGAGUUGU"LCCUAGU--GGA--AAGGCGPPUGGCCGPU+ACPAAAAG-------------------AUAGCAAGAUCA"UACUUGCCAGCUCAGCCA
tRNAAsnGPUAsterias amurensismitochondrial -UGGGUUGU"GCCUAAU--GGA--AAGGCAAPUGGCCGPU6ACCAGGAG-------------------AUAACAAGAUCA"UACUUGUCAACUCAGCCA
tRNATyrGUAAsterias amurensismitochondrial -GGCAGGGUKGCAGAA"--GUD--AAUGCACPAAAPUGUA*AUPUAUAA--------------------AUAAAGGUPUAAUUCCUUUUCUUGCCACCA
tRNAIniCAUAsterina amurensiscytosolic -AGCAGAGUKLCGCAGU--GGA--AGCGUGCUGGGCCCAU6ACCCAGAG-------------------7D?CGAGGAPCG"AACCUCGCUCUGCUACCA
tRNAAlaIGCBombyx moricytosolic -GGGGGCGUALCUCAGAD-GGU--AGAGCRCUCGCJUIGCOP#PGAGAG-------------------7UA?CGGGAPCG"UACCCGGCGCCUCCACCA
tRNAAlaIGCBombyx moricytosolic -GGGGGCGUALCUCAGAD-GGU--AGAGCRCUCGCJUIGCOP#PGAGAG-------------------7UA?CGGGAPCG"UACCCGGCGCCUCCACCA
tRNAPhe#AABombyx moricytosolic -GCCGAAAUALCUCAGDD-GGG--AGAGCRPPAGABU#AAKAPCUAAAG-------------------7D?CCUGGTPCA"UCCCGGGUUUCGGCACCA
tRNAPhe#AABombyx moricytosolic -GCCGAAAUALCUCAGDD-GGG--AGAGCRPPAGABU#AAKAPCUAAAG-------------------7D?CCUGGTPCG"UCCCGGGUUUCGGCACCA
tRNAGlyGCCBombyx moricytosolic -GCAJCGGUKGUUCAGU--GGD--AGAAUGCUCGCCUGCCA?GCGGGCG-------------------G-???GGGTPCG"UUCCCGGCCGAUGCACCA
tRNAGly,CCBombyx moricytosolic -GCGJUGGUKGUGPAAD--GGDC-AGCAUAGPUGCCU,CCAAGCAGUUG-------------------A-U??GGGTPCG"UUCCCGGCCAACGCACCA
tRNAIleIAUBombyx moricytosolic -GGCCCAUUALCUCAGDD-GGDN-AGAGCRPCGUGCUIAU6ACGCGAAG-------------------7U?G?GGGTPCG"UCCCCUCAUGGGCCACCA
tRNAAsp8UCBos tauruscytosolic -GGUGCCGUALCGPAGD--#GC--A.CG.GACUCUBU8UCAAAGAGUGG-------------------7A?.UGAGTPCG"UACUCAACGGCACCGCCA
tRNAPhe#AABos tauruscytosolic -GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCG"UCCCGGGUUUCGGCACCA
tRNAPhe#AABos tauruscytosolic -GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCA"UCCCGGGUUUCGGCACCA
tRNAPhe#AABos tauruscytosolic -GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCG"UCCCGGGUUUCGGCACCA
tRNALeuIAGBos tauruscytosolic -GGUAGCGUGLCMGAGC--GGDCPAAGGCRCUGGAZUIAGKCPCCAGU-CPCP---UC------GGGGG-?GUGGGTPCG"AUCCCACCGCUGCCACCA
tRNALeu°AABos tauruscytosolic -GUCAGLAUGLCMGAGU--GGDCPAAGGCLCCAGACU°AAKPPCUGGJ-CPCC---GUAU----GGAGG-?GUGGGTPCG"AUCCCACUUCUGACACCA
tRNALeuIAGBos tauruscytosolic -GGUAGCGUGLCMGAGC--GGDCPAAGGCRCUGGAZUIAGKCPCCAGU-CPCP---UC------GGGGG-?GUGGGTPCG"AUCCCACCGCUGCCACCA
tRNALeuCAGBos tauruscytosolic -GUCAGLAUGLCMGAGC--GGDDCAAGGCRCUGCGJUCAGK.CGCAGJ-CPCC---CU------GGAGG-?GUGGGTPCG"AUCCCACUUCUGACACCA
tRNAAsnQUUBos tauruscytosolic -GUCUCUGUKLCGCAADC-GGDX-AGCGCRPPCGGCUQUU6ACCGAAAG-------------------7DUGGUGG@PCG"GCCCACCCAGGGACGCCA
tRNAGlnCUGBos tauruscytosolic -GGUUCCAUKGUGPAAD--#GDD-AGCACUCPGGABUCUGAAPCCAGCG-------------------A-U?CGAGPPCA"AUCUCGGUGGAACCUCCA
tRNAArgCCGBos tauruscytosolic -GACCCAGUKLCCUAAD--#GAD-AAGGCAPCAGCBUCCGKAGCUGGGG-------------------ADUGPGGGTPCG"GUCCCAUCUGGGUCGCCA
tRNAArgCCUBos tauruscytosolic -GCCCCAGUKLCCUAAD--GGAD-AAGGCAPUGGC'UCCU6AGCCAGGG-------------------ADUGPGGGTPCG"GUCCCAUCUGGGGPCCCA
tRNAArg3CPBos tauruscytosolic -GGCUCCGUKGCGCAAD--GGAD-AGCGCAPPGGA'U3CP6AUPCAAAG-------------------7DU?CGGGTPCG"GUCCCGGCGGAGUCGCCA
tRNAThrIGUBos tauruscytosolic -GGCCCUGUKLCUAGCD--GGDC-AAAGCRCCUGU'UIGU6AACAGGAG-------------------AD?CUGGGUPCG"AUCCCAGCGGGGC?UCCA
tRNATrpBCABos tauruscytosolic -GACCUCLUKLCGCAAD--#GD--AGCGCRPCUGABUBCAKAZCAGAAG-------------------7DUGCGUGPPCG"AUCACGUCGGGGUCACCA
tRNATyr9PABos tauruscytosolic -CCUUCLAUALCUCAGDD-GGXU-AGAGCRRAGGACU9PAKAZCCUUAG-------------------7D?GCUGGTPCG"UUCCGGCUCGAAGGACCA
tRNASec1CABos tauruscytosolic -GCCCGGAU_CCUCAGU--GGUC-UGGGGUGCAGGCU1CA+ACCUGUAGCUGUC--UAGC---GACAG---AGUGGUPCA"UUCCA_UUUCGGGCGCCA
tRNAGlu∃UCBos taurusmitochondrial -GUUCUUGU"GUUGAA---UG---ACAACLAPGGUUUUCAUAPCAUUA-------------------G-U?AUGGUPAG"UUCCAUGUAAGAAUACCA
tRNAPheGAABos taurusmitochondrial -GUUGAUGU"LCUU-AA--CCC--AAAGCAAGGCACUGAAAAPGCCUAG-------------------A-UGAGU-CUCCCA--ACUCCAUAAACACCA
tRNAGlyUCCBos taurusmitochondrial -AUUCUUUU"LUAUUAA--CU---AGUACAGCUGACUUCCAAPCAGCUA-------------------G-UUUCGGUCUAGU-CCGAAAAAGAAUACCA
tRNAIleGAUBos taurusmitochondrial -AGAAAUAUKUCUGACA-------AAAGARPUACAUUGAU6GUGUAAAU-------------------AAUAGAGGUUCA"ACCCUCUUAUUUCUACCA
tRNALys∃UUBos taurusmitochondrial -CACUAAGA"LCUAU---------AUAGCACPAACCUUU6AGUUAGAG-------------------AUUGAGAGCCAU"UACUCUCCUUGGUGACCA
tRNALeuÊAABos taurusmitochondrial -GUUAAGGUKLCAGAGCCCGGDA-AUUGCAPAAAACUÊAAACPUUUAUA-------------------UC?AGAGAUUCA"AUCCUCUCCUUAACACCA
tRNALeuUAGBos taurusmitochondrial -ACUUUUAA"LGAUAGU--AGDUU-AUCCLPPGGPCUUAGKAACCAAAA---------------------AAUUGGUGCAACUCCAAAUAAAAGUACCA
tRNAArgUCGBos taurusmitochondrial -UGGUACUU"GUUUAA---AAU--AAAAUAAAUGAUUUCGACPCAUUAG-------------------A-UUAUGAUUUAAU-UCAUAAUUACCAACCA
tRNASerGCUBos taurusmitochondrial -GAAAAAG-U----------------AUGCAAGAACUGCU6AUUC_UGCUC--------------------?CAUAUCUAAU_UAUGGCUUUUUCGCCA
tRNASerUGABos taurusmitochondrial -GAGAGAG-A-CAUAGA--GGD--UAUGAPGPPGG'UUGA+ACCAAUAG-------------------U-AGGGGGUPCG"UUCCUUCCUUUCUUACCA
tRNAThrUGUBos taurusmitochondrial -GUCUUUGU"GUACAU---CU---AAUAUACUGGU'UUGU6AACCAGAG-------------------A-AGGAGAACAACU_CCUCCCPAAGA?UCCA
tRNAValUACBos taurusmitochondrial -CAAGAUAU"LCUUAA---AC---AAAGCAPCCAGUUUACACCUAGAAG-------------------A-CUUCA-UUCAUUA-UGAAUAUCUUGACCA
tRNATrpÊCABos taurusmitochondrial -AGGAAUUU"LGUUAA---AC---AGACCAAGAGCCUÊCA*AGCCCUAA-------------------G-?AAGUACAAUU--UACUUAAUUCCUGCCA
tRNAIni>AUBos taurusmitochondrial -AGUAAGGUCAGCUAAUU------AAGCUAPCGGGCC>AUACCCCGAAA-------------------A-UGPUGGUUUAUAUCCUUCCCGUACUACCA
tRNAAlaUGCBos taurusmitochondrial -GAGGAUUU"LCUUAA---UU---AAAGULGPUGAUUUGCAUPCAAUUG-------------------A-UGUAAGGUGPAGUCUUGCAAUCCUUACCA
tRNACysGCABos taurusmitochondrial -AGCCCUGUKGUGAAUU-------UACACGPPGAAPUGCA+APUCAGAG-------------------A-AGCAGCUUCA"U-UCUGCCGGGGCUUCCA
tRNAAspQUCBos taurusmitochondrial -GAGGULUU"GUAAAAC-------AUUAUAPAAUPUUQUCAAAGUUAAG-------------------U-UACAAGUGAAAGUCCUGUACACCUCACCA
tRNAHisQUGBos taurusmitochondrial GGUAAAUAU"LUUUAA---CA---AAAACAPUAGAUUQUGAAPCUAACA-------------------A-UAGAAACUCAUU_CUUCUUAUUUACCCCA
tRNAAsnQUUBos taurusmitochondrial -UAGAUUGA"LCCAGUU--AGCU-AGGGUGPPUAGCUQUU6ACUAAAGU-------------------UU?GUGGGGGUGGAGCCCACCAGUCUAGCCA
tRNAProUGGBos taurusmitochondrial -CAGGGAAU"LUUUAA---AU---AGAACUPCAGCUUUGGKGGUUGAUG-------------------G-UGAGAC-UGCA--GUUUCUUCCUUGACCA
tRNATyrQUABos taurusmitochondrial -GGUAAAAUKLCUGAGC-------AAAGCAUPAGACUQUA*APCUAAAG-------------------A-UAGAGGUPUGACUCCUCUUUUUACCACCA
tRNAGln∃UGBos taurusmitochondrial -UAGAAUUUKGUGUAAUU-GGG--AGCACGAAGAGUUUGKAPPCUUAG-------------------G-AGUAGGUPCGAUUCCUAUAGUUCUAGCCA
tRNAPhe#AABrassica napuscytosolic -GCGGGGAUALCUCAGDD-GGG--AGAGCRPCAGABU#AAYAPCUGAAG-------------------7DCGCGUGTPCG"UCCACGCUCACCGCACCA
tRNALeuIAGCaenorhabditis eleganscytosolic -GGAGAGAUGGCMGAGC--GGDCUAAGGCGCUGGUUUIAGGCACCAGU-CCCU---UC------GGGGG-CGUGGGTUCGAAUCCCACUCUCUUCACCA
tRNALeuCAGCandida albicanscytosolic -GAUACGAUGGCMGAGD--#GDD-AAGGCRAAGGAUGCAGKPPCCUU--UGGGC--AUU----GCCCG--?GCAGGTPCG"ACCCUGCUCGUGUCGCCA
tRNALeuBAACandida cylindraceacytosolic -GGCCGUUUGLCMGAGD--#GDCDAAGGCRUCUGABUBAAKAPCAGAJ-CUC----GUAA-----GAGG-?GUGUGTPCG"ACCACACAGCGGUCACCA
tRNALeuIAGCandida cylindraceacytosolic -GGUUCUCUGGCMGAGD--GGDCDAAGGCRCAUGGPUIAGKPCCAUGU-CUC----UUCG-----GAGG-?GCGAGTPCG"ACCUCGCGGGAAUCACCA
tRNALeuIAGCandida cylindraceacytosolic -GGCUCUCUGGCMGAGD--GGDCDAAGGCRCUAGGPUIAGKPCCUAGU-CUC----UUCG-----GAGG-?GCGAGTPCG"ACCUCGCGGGAGUCACCA
tRNASerCAGCandida cylindraceacytosolic -GACACCGUGLCMCAGD--#GDD-ACGGCRPUGGACGCAGAAPCCAUU-GAGC---UU------GCUCG-?GCGGGTPCG"AUCCCGUCGGUGUCUCCA
tRNASer&GACandida cylindraceacytosolic -GGUGCAAUGGCMGAGD--#GDD-AAGGCRACGGAPU&GA+CPCCGUJ-GGGA---UUC-----UCCCU-?GCAGGTPCG"AUCCUGUUUGCAUCGCCA
tRNASerIGACandida cylindraceacytosolic -GGCAUCUUGGCMGAGD--#GDD-AAGGCRAAAGAPUIGA+APCUUUJ-GGGC---UCU-----GCCCG-?GCAGGTPCG"GUCCUGCAGAUGUCGCCA
tRNASerCGACandida cylindraceacytosolic -GGCAACUUGGCMGAGD--#GDD-AAGGCRUGACA'UCGA+APGUCAJ-GGGU---UU------ACCCG-?GCAGGTPCG"AUCCUGCAGUUGUCGCCA
tRNASerGCUCandida cylindraceacytosolic -GUUAAUGUGGCMGAGD--GGDD-AAGGCRCUUCC'UGCU+AGGAAGJ-GGGC---UCU-----GCCCG-?GCAGGTPCG"AUCCUGUCAUUAACGCCA
tRNASecUCAChlamydomonas reinhardtiicytosolic -GCCGCUGU_CUUGGCG--GGU-GCUGAGUGCGGUCUUCA+AACCGUAGAGGCC--GGAA---GGCCU---AGUGGUPCA"UUCCA_UCGGCGGCGCCA
tRNAGluNUCChlamydomonas reinhardtiiplastidic -GCCCCCAUCGUCUAGA--#GCCDAGGACACCUCCCUNUCACGGAGAAA-------------------A-?GCGGATPCGAAUUCCGCUGGGGGUACCA
tRNALeuUA7Chlamydomonas reinhardtiiplastidic -GCCUUCGUGAUC-GGAAU#GDAGA-GAUCCUGGUCUUA7KAACCAGCUG------CUGAA------AGGCGGCGGTPCAAAUCCGCCCGAAGGCACCA
tRNAGlyUCCCodium fragileplastidic -GCAGUACUGGUGUAAD--#GDD-AGCGCCUUAGAPUUCCAAPCUAAAG-------------------G-UAGGGGTPCGAUUCCCCUGUACUGCUCCA
tRNALysNUUCodium fragileplastidic -GGGUUACUAACUCAAD--#GD--AGAGUAAPCGGCUNUU6ACCGAUAA-------------------7DUCUGGGTPCAAUUCCCAGGUAACUCACCA
tRNAMetCAUCodium fragileplastidic -GCCUAUUUALCUCAGDD-#GDD-AGAGCAPCCGPCUCAUHCGCGGGAA-------------------7DGACUAGTPCAAAUCUAGUAAUAGGCACCA
tRNAArgICGCodium fragileplastidic -GGGUAUAUAACUCAGD--#GADUAGAGUPPAUGGCUICGHACCAUAAA-------------------7DCGGGGGTPCGAAUCCCUCUAUACUCACCA
tRNALeuNAACucumis sativuscytosolic -GUCAGGAUGLC?GAG-D-GGDCXAAGGCRCCAGACUNAAKPPCUGGJ-CCUC---UAAG----GAGGG-?GUGGGTPCA"AUCCCACUUCUGACACCA
tRNAAspQUCDidelphis virginianamitochondrial -AAGAUAUU"LUAAAA---UUC--AUUACAPAACUPUQUCAUAGUUAAA-------------------U-UAUAGGUPUAACUCCUAUAUAUCUUACCA
tRNAGlu2UCDrosophila melanogastercytosolic -UCCCAUAUGGUCPAGD--GGCD-AGGAUAUCUGGBU2UCACCCAGAAG-------------------G-CCCGGGTPCGAUUCCCGGUAUGGGAACCA
tRNAPhe#AADrosophila melanogastercytosolic -GCCGAAAUALCUCAGDD-GGG--AGAGCRPPAGABU#AAKAPCUAAAG-------------------7DCCCCGGTPCA"UCCCGGGUUUCGGCACCA
tRNAHisGUGDrosophila melanogastercytosolic GGCCGUGAUCGUCPAGD--GGDD-AGGACCCCACGPUGUGKCCGUGGUA-------------------A-CC?AGGUPCG"AUCCUGGUCACGG?ACCA
tRNALysCUUDrosophila melanogastercytosolic -GCCCGGCUALCUCAGDC-GGD--AGAGCAPGAGACUCUU6APCUCAGG-------------------7DCGUGGG\PCG"GCCCCACGUUGGGCGCCA
tRNALys)UUDrosophila melanogastercytosolic -GCCCGGAUALCUCAGDC-GGD--AGAGCAPPGGACU)UU6APCCAAGG-------------------7D?CAGGG\PCA"GUCCCUGUUCGGGCGCCA
tRNASerGCUDrosophila melanogastercytosolic -GACGAGGUGGCMGAGD--#GDD-AAGGCRPPGGA'UGCUEAPCCAAJ-GUGC---U'U-----GCACG-?GUGGGTPCG"AUCCCAUCCUCGUCGCCA
tRNASerIGADrosophila melanogastercytosolic -GCA#UCGUGGCMGAGC--#GDD-AAGGCRUCUGA'UIGA+APCAGAJ-UCCC---U'U-----GGGAG-?GUAGGTPCG"AUCCUACCGACUGCGCCA
tRNASerCGADrosophila melanogastercytosolic -GCA#UCGUGGCMGAGD--#GDD-AAGGCRUCUGA'UCGA+APCAGAJ-UCCC---U'U-----GGGAG-?GUAGGTPCG"AUCCUACCGGCUGCGCCA
tRNAValIACDrosophila melanogastercytosolic -GUUJCCGUKGUGPAGC--GGDX-AUCACAPCUGCBUIACA?GCAGAAG-------------------7CC<CCGGTPCG"UCCCGGGCGGAAACACCA
tRNAValCACDrosophila melanogastercytosolic -GUUUCCGUAGUGPAGC--GGDX-AUCACGPGUGCUUCACACGCACAAG-------------------7DCCCCGGTPCG"ACCCGGGCGGGAACACCA
tRNAValNACDrosophila melanogastercytosolic -GGUJCCAUAGUGPAGC--GGDN-AUCAC;PCUGCPUNACACGCAGAAG-------------------7D?UCCGGTPCG"UCCCGGAUGGAACCACCA
tRNAIniCAUDrosophila melanogastercytosolic -AGCAGAGUKLCGCAGU--GGA--AGCGULCUGGGCCCAU6ACCCAGAG-------------------7D?CGAGGAUCG"AACCUUGCUCUGCUACCA
tRNATyrQPADrosophila melanogastercytosolic -CCUUCGAUALCUCAGDD-GGX--AGAGCRGPGGACUQPAKAJCCAUAG-------------------7DCGCUGGTPCA"AUCCGGCUCGAAGGACCA
tRNASec1CADrosophila melanogastercytosolic -GCCCCACU_CUUCGGU--GGU-CCGGGGUGCGGACU1CA+AUCCGUAGUCGAU--UUGC---GUCGA---AGUGGUPCGAUUCCA_UGGGGGGCGCCA
tRNAAspGUCEuglena graciliscytosolic -UCUUCGGUAGUAPAGD--#GDA-AGUAU;PCCGCCUGUCA<GCGGAAG-------------------A-<HCGGGTPCAHUUCCCGGCCGGAGAGCCA
tRNAPhe#AAEuglena graciliscytosolic -GCCGACUUALCUBAGDD-GGG--AGAGCRPPAGABU#AAYAPCUAAAG-------------------7UCCCUGGTPCG"UCCCGGGAGPCGGCACCA
tRNAPheGAAEuglena gracilisplastidic -GCUGGGAUAGCUCAGDU-G#D--AGAGCGGAGGACUGAA*APCCUUGU-------------------7.CACCAGTPCAAAUCUGGUUCCUAGCACCA
tRNAIniCAUEuphausia superbacytosolic -AGCAGAGUKLCGCAGU--GGA--AGCGULCUGGGCCCAU6ACCCAGAG-------------------7UCGGUAGAPCG"AACUACUCUCUGCUACCA
tRNASerUGAGallus galluscytosolic -AAGAAAGA"LCAUUAAGUGGDUUGAUGCLGPUGG'UUGAHACCAACAU-------------------G-UGAGGGTPCG"UUCCUUCCUUUCUUGCCA
tRNATrpBCAGallus galluscytosolic -GACCUCGUKLCGCAAC--#GD--AGCGCRPCUGABUBCAKAZCAGAAG-------------------7CUGCGUGPPCG"AUCACGUCGGGGUCACCA
tRNAMet>AUGallus gallusmitochondrial -AGUAAGGUCAGCUAA---CU---AAGCUAPCGGGCC>AUACCCCGAAA-------------------A-UGAUGGTPUAACCCCUUCCCCUACUACCA
tRNALeuBAAGlycine maxplastidic -GCCUUGGUGGUGAAAU--#GDA-GCCACGCGAGACUBAAHAPCUCGU-GCU----ACAG-----AGCG-UGGAGGTPCGAGUCCUCUUCAAGGCACCA
tRNALeuJAAGlycine maxplastidic -GGGGAUAUGGCGAAAUU-#GDA-GACGCPACGGACUJAAHAPCCGUC-GACUU--AAG----AAAUCA-UGAGGGTPCAAGUCCCUCUAUCCCCACCA
tRNALeuUA7Glycine maxplastidic -GCCGCUAUGGUGAAAUU-#GDA-GACACGCUGCUCUUA7KAAGCAGU-GCU----AG-------AGCA-UCUCGGTPCGAGUCCGAGUAGCGGCACCA
tRNAGlyÊCUHalocynthia roretzimitochondrial -GCGUULAU"GUUUAA---GU---AAAAUAGAUUCUUÊCUAGGPAUAAG---------------------UUAGGGUUGG---UCCCUUUGAUGCACCA
tRNAGlyUCCHalocynthia roretzimitochondrial -GCUGUGUU"GUAUAAA--GU---AAUAPAPGUGAPUUCCAAPCAUGGG---------------------AUCCUU-------UAGGGACGUAGUACCA
tRNASerGCUHalocynthia roretzimitochondrial -AAGGGUGAUUAGGAA---------UGUUAGAAAGPUGCUAPPUUUUUG-------------------AUAUPGAGUUCGAAUCUCGAGGCUCUUGCCA
tRNAMetÊAUHalocynthia roretzimitochondrial -GGUAAUAU"LGUUAAUA--U---AAACCAGAAAGUUÊAUUPCUUUCUA-------------------A-UAACGAA-------UGPUUAUUACUUCCA
tRNATrpÊCAHalocynthia roretzimitochondrial -AGGAGAUU"LUUUAAGU--U---AAAUCAAUUGUUUÊCA*AACAGUAG-------------------U-UAUAUAGAAUGAUUAUAUAUUUCCUGCCA
tRNAMetCAUHalocynthia roretzimitochondrial -ACAACAGU"AACUAUGAA-AA--AGUUUGUGGGGUUCAUKGUCCUGAU----------------AAUGUGAUAUUAAAAUAUAUUGCCUGUUGAACCA
tRNAAlaIGCHomo sapienscytosolic -GGGGGAUUALCUCAAAD-GGD--AGAGCRCUCGCJUIGCOP#CGAGAG-------------------7UAGCGGGAPCG"UGCCCGCAUCCUCCACCA
tRNAAlaIGCHomo sapienscytosolic -GGGGAAUUALCUCAAAD-GGD--AGAGCRCUCGCJUIGCOP#CGAGAG-------------------7UAGCGGGAPCG"UGCCCGCAUUCUCCACCA
tRNAGluCUCHomo sapienscytosolic -UCCCUGGUGLUCPAGU--GGDP-AGGAUUCGGCGCUCUCACCGCCGCG-------------------G-C??GGG\PCGAUUCCCGGUCAGGGAACCA
tRNAPhe#AAHomo sapienscytosolic -GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCG"UCCCGGGUUUCGGCACCA
tRNAGlyCCCHomo sapienscytosolic -GCGBCLCUGGUGPAGU--GGD--AUCAUGCAAGAJUCCCAUZCUUGCG-------------------A-C??GGGTPCG"UUCCCGGGCGGCGCACCA
tRNAGlyGCCHomo sapienscytosolic -GCAJULGUGGUUCAGU--GGD--AGAAUUCUCGCCUGCCA?GCGGGAG-------------------G-???GGGTPCG"UUCCCGGCCAAUGCACCA
tRNAHisGUGHomo sapienscytosolic ;GCCGUGAUCGUAPAGD--GGDD-AGUACUCUGCGPUGUGGCCGCAGCA-------------------A-??UCGGUPCG"AUCCGAGUCACGGCACCA
tRNALeu.AAHomo sapienscytosolic -GUCAGLAUGLC