RNA sequences with modifications

             10|       20|                                                          30|       40|       50|       60|                              70|       80|       90|       100|      110|                         
TypeSubtypeOrganism
012------345678901234567890---1------------------------------------------------234567890123456789012345678901234567890123456-----------------------7890123456789012345678901234567-8901234567890123------------------456
snRNAU5Caenorhabditis elegans AA-------CUCUGGUUCCUCUGCAUUUAA------------------------------------------------CCGUGAAAAUCUPUCGCCUUUPACPAAAGAUUUCCGUGCAAAGGA----------------------GCAUUUACUGAGUAUUACAUACAAUUUUUGGAGACUCCUUGAGAAAGCGGG----------------UCA
snRNAU5Chlamydomonas reinhardtii :J----CCGCGACGAGCUGAACGCGU---A------------------------------------------------#CGAAUAPCUCUPUC#CCUJUPABPAAAGAGAUCCGCGAGUUUUG----------------------CUCACGCAGUCGCAUAUCCAUCUUUUUGUGGGGCUUUUGC---------------------------CUU
snRNAU5Crypthecodinium cohnii =J-------BACAGUGPUCACUUCA----A------------------------------------------------CCGAAUCAAPCUPJC#CCUJUPABPAAAGGUUGCCGUGAAUGGGA----------------------CACAUCAAUGUGAAUCUCUCAAUUUUUGAGGGCUCUGCCC---------------------------CAC
snRNAU5Drosophila melanogaster :J------ACUCUGGUUUCUCUUCAAU--G------------------------------------------------UCGAAUAAAPCUUUC#CCUJUPABPAAAGAUPUCCGUGGAGAGGA----------------------ACACUCUAAGAGUCUAAAACUAAUUUUUU-AGUCAGUCUUGUCGCAAGACUG------------GGGCCA
snRNAU5Homo sapiens :J------ACUCUGGUUUCUCUUCAG---A------------------------------------------------UCGCAUAAAUCUUUC#CCUJUPABPAAAGAUPUCCGUGGAGAGGA-----------------------ACAACUCUGAGUCUUAACCCAAUUUUUUGAG-CCUUGCCUUGGCAAGG------------------CUA
snRNAU5Leptomonas collosoma AC----------------------------------------------------------------------------CGGCAUCACUGCUUCGACUUJUACUA:GCAGCGCAG-----------------------------------CCAACACAUAUCAUGUCAAAUUUUGGGAACCCUUGU------------------------GGUUUU
snRNAU5Mus musculus :J------ACUCUGGUUUCUCUUCAG---A------------------------------------------------UCGUAUAAAUCUUUC#CCUJUPABPAAAGAUPUCCGUGGAGAGGA-----------------------ACAACUCUGAGUCUUAAACCAAUUUUUUGAGGCCUUGUCUUGGCAAGG------------------CUA
snRNAU5Physarum polycephalum :B------ACGCGGCUUPCPCGGCAG---A------------------------------------------------UCGAAUUAPUCUPJC#CCUJUPABPAAAGAAUACCGUGUCGGGGA--------------------UGCAUAUUUGCGUCUUUUGAUCGAAUUUUUUGCGGCCUCUCUUUACGAGUGGC----------------UAU
snRNAU5Pisum sativum AG-------CCGUGUGAUGAUGACAU---A------------------------------------------------GCGAACUAUJCUPUC#CCUJUPABPAAAGAAUACPCGUGUCAGCG----------------------UCACAAUUAGCGGCAUACGCUAGUUUUUGGAAGAGUUCUC--------------AAUUUUGAGGGCUCUG
snRNAU5Rattus norvegicus :J------ACUCUGGUUUCUCUUCAG---A------------------------------------------------UCGUAUAAAUCUUUC#CCUJUPABPAAAGAUPUCCGUGGAGAGGA-----------------------ACAACUCUGAGUCUUAAACCAAUUUUUUGAGGCCUUGUCUUGAGCAAG------------------GCU
snRNAU5Saccharomyces cerevisiae CAAGCAGCUUUACAGAUCAAUGGCGGAGGGAGGUCAACAUCAAGAACUGUGGGCCUUUUAUUGCCUAUAGAACUUAUAACGAACAUGGUUCUUGCCUUPUACCAGAACCAUCCGGGUGUUGUCUCCAUAGAAACAGGUAAAGCUGUCCGUUACUGUGGGCUUGCCAUAUUUUUUGGAACUUUUCUGCCCUUUUUCUCAAUGAGUAAGGAGGGCGU
snRNAU5Schizosaccharomyces pombe AUAAUCCGUCAAAGCACUUUGCAAAAGCUA------------------------------------------------ACGUAUCPGUUUCUU#CCUJUPABCAGAAACAGCCGUUUGUAAGG----------------------UGUGCUAAUUUGACU---GUAUAGUUUUUGAAUCUUUUUCUUGAA----------------------ACA
snRNAU5Tetrahymena pyriformis :J-------CACAGAACUCAGCUCAA---U------------------------------------------------ACGCUUUAAUUUPUC#CCUJUPABPAAAGAUPACCGUGGGCUGGG----------------------UUCUACAAUGUGAAUUAUUAAAAUUUUUGAGGAUUGUGUG-----------------------AAUCCUA
snRNAU5Tetrahymena thermophila :J-------CACAGAACUCAGCUCAU---U------------------------------------------------ACGCUUUAAUUUPUC#CCUJUPABPAAAGAUPACCGUGGGCUGGG----------------------UUUACCAAUGUGAAUUAUUAAAAUUUUUGCAGGAUUCUUU-----------------UGAAUCCUCUCAC

Explanation:

For tRNA and rRNA the numbering scheme above the alignment is based on the E.coli sequences. For all other RNA types it refers to the first sequence in the alignment. Helical regions are colored in red, loop and bulge regions in black. Sequence alignment and secondary structure for rRNA are presented according to CRW database. Modified bases are underlined and hyperlinked.The underscore sign (_) in tRNA alignment indicates an insertion.
Please note that the modifications are based on experimental data, which may not always cover the entire sequence. Thus, modifications existing in vivo may be missing.