RNA sequences with modifications

Showing 8 sequences.

        10|        20|       30|        40|       50|       60|       70|       80|       90|      100|      110|      120|      130|      140|                       
TypeSubtypeOrganism
0-1234567890-123456789012345678901234567-8901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123------------------4
snRNAU4Caenorhabditis elegans -AGCUUUGCGC-UGGGGCGAUAACGUGACCAAUGAGGC--UUUGCGAGGUGCGUUUAUUGCUGGUPGAAAACUUUPCCCAAUUGCCCGCGAUGU-CCCCUGAAACAUGGGUGGCAUACGCAAUUUUUGAACNCUCUAGGAGGCAGA------------------A
snRNAU4Drosophila melanogaster -:GCUUAGCGC-AGUGGCAAUACCGUAACCAAUGAAGCC-UCCCUGAGGUGCGGUUAUUGCUAGUUG:AAACUUUAACCAAC-CCACGCCAUGG-GACGUGAAAUACCGUCCACUACGGCAAUUUUUGGAAGCCCPPACGAGGGCU-----------------AA
snRNAU4Gallus gallus -:#CPUUGBGC-AGUGGCAGUAUCGUAGCCAAUGAGGUU-AAUCCGAGGCGCGAUUAUUGCUAAUUG:AAACUUPUCCCAAPACCCCGCCGUGACGACUUGCAAUAUAGUCGGCAUUGGCAAUUUUUGACAGUCUCUACGGAGACU-----------------GG
snRNAU4Homo sapiens -:#CPUUGBGC-AGUGGCAGUAUCGUAGCCAAUGAGGUC-UAUCCGAGGCGCGAUUAUUGCUAAUUG:AAACUUPUCCCAAPACCCCGCCGUGACGACUUGCAAUAUAGUCGGCACUGGCAAUUUUUGACAGUCUCUACGGAGACU------------------G
snRNAU4Leptomonas collosoma AAGCCUUGCGCAGGGAGAUGUGAA----------------CGCAAGAACCUCAGUGAUUGUUCAUUUAGUGCUAUACUA:AAACUCCA-----------------#UACUCCUAUACGGGAAUAUUUGCAUCCACCAAGGGUGGGG-----------------AA
snRNAU4Mus musculus -:#CPUUGBGC-AGUGGCAGUAUCGUAGCCAAUGAGGUU-UAUCCGAGGCGCGAUUAUUGCUAAUUG:AAACUUPUCCCAAPACCCCGCCAUGACGACUUGAAAUAUAGUCGGCAUUGGCAAUUUUUGACAGUCUCUACGGAGACU------------------G
snRNAU4Rattus norvegicus -:#CPUUGBGC-AGUGGCAGUAUCGUAGCCAAUGAGGUU-UAUCCGAGGCGCGAUUAUUGCUAAUUG:AAACUUPUCCCAAPACCCCGCCGUGACGACUUGCAAUAUAGUCGGCAUUGGCAAUUUUUGACAGUCUCUACGGAGACU-----------------GG
snRNAU4Vicia faba -AUCUZUGCGCZUGGGGCAAUGACGUAGCUAGUGAGGUPCUAACCGAGGCGCGUCUAPUGCUGGUUG:AAACUAPUUGCCAAACCCC----------UCUUAGGCUUGGGCUUGGGUUCAAGCCUUUGAGAAUUUCUGGAAGGACUCCCUUUGGGGUAAAGUCUA

Explanation:

For tRNA and rRNA the numbering scheme above the alignment is based on the E.coli sequences. For all other RNA types it refers to the first sequence in the alignment. Helical regions are colored in red, loop and bulge regions in black. Sequence alignment and secondary structure for rRNA are presented according to CRW database. Modified bases are underlined and hyperlinked.The underscore sign (_) in tRNA alignment indicates an insertion.
Please note that the modifications are based on experimental data, which may not always cover the entire sequence. Thus, modifications existing in vivo may be missing.