RNA sequences with modifications

Showing 6 sequences.

        10|       20|        30|       40|       50|       60|       70|       80|       90|                   100|        110|      120|                                                                                                                                                                                                                                                                                                                                                                                   130|      140|       150|              160|                                                                                                170|      180|                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
TypeSubtypeOrganism
012345-67890123456789012345678-9012345678901234567890123456789012345678901234567890123456789012345678-------------901234567--8901234567890123456-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------7890123456789012-345678901234--------5678901234----------------------------------------------------------------------------------------56--789012345678901234------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------56
snRNAU2Caenorhabditis elegans AUCGCU-UCUPCGGCUPAUUAGCUAAGAPCAAAGUGUAGPAPCPGPPCUUAUCGUAPUAACCUACGGUAUACACUCGAAUGAGUGUAAUAA--------AGGUUA--UAU--GAUUU-UUGGAACCUagggaag---acu--cggggcuugcuccgacuucc--c----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------aaGGGUCGUCCUGGCG-------UUGCACU-GC----UGCCGGGCUCGGCCCAGU-------------------------------------
snRNAU2Homo sapiens :JCGCP-UCU-C#GCCPUUU#GCUAA#AUCAχ-GUGPAGPAPBPGPUCUJAUCAGUPUAAPAUBUGAUACGUCCUCUAUCCGAGGACAAU---------APAPUAAAUG---GAUUU-UUGGAGCAG-ggagauggaaua---ggagcuugcuccguccacu-cc----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------acGCAUCGACCUGG-------UAUUGCAGU-ACCU----CCAGGAACGGUGCACC-------------------------------------
snRNAU2Rattus norvegicus :JCGCPPUCU-C##CCPUUUG#CUAA#AUCAχ-GUGPAGPAPBPGPPCUJAUCAGUPUAAPAPBUGAUACGPCCPCUAUCCGAGGACAAU---------APAPUAAAUG---GAUUU-UUGGAACUA-ggaguuggaaua---ggagcuugcuccguccacu-cc----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------acGCAUCGACCUGG-------UAUUGCAGU-ACCU----CCAGGAACGGUGCACC-------------------------------------
snRNAU2Saccharomyces cerevisiae ACGAAUCUCU-UUGCCUUUUGGCUUAGAUCAA-GUGPAGUAUCPGPUCUUUUCAGUGPAACAACUGAAAUGACCUCAAUGAGGCUCAUUACCUUPUAAUUUGUUACAAUACACAUUUUUUGGCACCCaaaauaauaaaauggacgggaagagacuuuuuaagcaaguuguuuuccgcuaaugucaggucucacuacuuuuugcugcuauuuuucuucgcucaugguuucuucauaaggcguuuuuaugaugguuuuucgaaauugguuuuugagacgacgguugcucaagguuauuguuuuuguuuucuucugguuguuuucuauuuucuuuuuuuuagcuuucuguuucucccuuaguuuggcuuuuugcuucauacucuucccugucuuuccgagccguuuauguccaacgcgggauuugguuuuucuuuaucgaugggaagaaauggugcuauaguagguugggagauaauauuuaugguauggggugcuagugcggauggggcgcucuuauuguugauuucuucgcucgucuucuuuuucugguggcgcugcaagaggaaguuuuucgacuuuguuaugauuuuugguuugcaaggaaaggugucuuacgauucuuuuuuugauguaauaggauaagcuugcuuauccccaaguaucggccaaaguuguugauuuuccuuuugaaguguccucgguuugaggggguguagggugggguuggucuacaauaagaguguuccauuguuaacgugcuggcgucuuuuacuauauuuuuuuucccaguuuauuuugugcuuauuuucucauugaggagaaggagcucuucucgcaggauauaaauggagguuugcuaaaggggaggagauguguuugugagaauacugcugagagaguucuggaagagaaaaaaaggaggcaauggaaggcguuugcugggaaaagagaagagccaugacugcaucuguuguuucaaggccaguuuuauuaaccgccuaugucauagaggcguuuuuuuuggagggauuugaagaaugcccggcggcaucaagaaacggacuugaugguugacgccuguuuuuAAAGUUAGAGACGUCGCGACCCUCGCACUUGU-GGAGUCGUUCUUGACUUUUACUUUGGUCGCUUGAUGUUUCUCUCGUCUUCCCGUUCGC
snRNAU2Schizosaccharomyces pombe AUUC-UCUCJ-UJGCCUUUUGGCUUA#AUCA=-GUGPAGPAPBPGPPCUUUUCAGUUUAAPCGCUGAAAUCACCUCACU--GAGGUGUUC---------CGAUUAA-UCU--UGUUU-UUGGUUUGA--guuggaaagccuc--uggcuugcuaugcuuuccgac----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------acUGGUGUUCUUGCUA--------UUGCACUUAC----UGGCAAGCGACGCCGAA-------------------------------------
snRNAU2Vicia faba AUACCPZZCP-CGGCCPUPU#GCUAA#AUBA:-GUGPAGP:PBPGPPCUUAUUAGUUUAAPAPCUGAUAUGUGGGCCAAUGGCCCACACG---------AUAUUAAAUU---UAUUUCUUGAGGGG--aagaggcc-accacaguagcuugcuauugggucucuu----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------acGUGUCGCUCUUGCG-------UUGCACU-AUA----GCAAUUGCUGGCGCACCCCA----------------------------------

Explanation:

For tRNA and rRNA the numbering scheme above the alignment is based on the E.coli sequences. For all other RNA types it refers to the first sequence in the alignment. Helical regions are colored in red, loop and bulge regions in black. Sequence alignment and secondary structure for rRNA are presented according to CRW database. Modified bases are underlined and hyperlinked.The underscore sign (_) in tRNA alignment indicates an insertion.
Please note that the modifications are based on experimental data, which may not always cover the entire sequence. Thus, modifications existing in vivo may be missing.